circad | circRNAs associated with diseases

hsa_circ_0001649
Gene	SHPRH	Organism	Human
Genome Locus	chr6:146209155-146216113:-	Build	hg19
Disease	Hepatocellular Carcinoma	ICD-10	Liver cell carcinoma (C22.0)
DBLink	Link to database	PMID	26600397
Experimental Method
Sample Type	Tissues	Comparison	Hepatocellular Carcinoma tissues and paired adjacent liver tissues
Method for Estimation	Quantitative PCR	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward AATGCTGAAAACTGCTGAGAGAA Reverse TTGAGAAAACGAGTGCTTTGG	Statistics	Fold Change : Downregulated pvalue : p<0.05
Citation
Qin, M, Liu, G, Huo, X, Tao, X, Sun, X, Ge, Z, Yang, J, Fan, J, Liu, L, Qin, W (2016). Hsa_circ_0001649: A circular RNA and potential novel biomarker for hepatocellular carcinoma. Cancer Biomark, 16, 1:161-9.